Kaihua Zhai1 *, Boyu Liu2 *, Lin Gao1
Abstract
Long non-coding RNA taurine up-regulated gene 1 (TUG1) participates in nervous system diseases, but its function in Parkinson’s disease remains unclear. This study explored the function and mechanism of TUG1 in Parkinson’s disease (PD). A PD model was constructed using SH-SY5Y cells induced by 1-methyl-4-phenylpyridinium (MPP+) in vitro and mice treated by 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) in vivo. The expressions of TUG1, miR-152-3p, phosphatase and tensin homolog (PTEN), tyrosine hydroxylase (TH), Bcl-2, cleaved caspase-3 expressions were determined by quantitative reverse transcription-PCR (qRT-PCR)and Western blotting. The viability, apoptosis, reactive oxygen species and release of inflammatory factors from SH-SY5Y cells and substantia nigra tissues were detected by commercial kits. The interaction between TUG1 and miR-152-3p were analyzed by dual-luciferase reporter assay. Hematoxylin-eosin (HE) and Immunohistochemical (IHC)staining were performed for assessing the pathological damage and proportion of TH-positive cells. In PD cell model and mice model, TUG1 expression was up-regulated and that of miR-152-3p was down-regulated. Further research showed that TUG1 sponged and regulated miR-152-3p expression. Silencing of TUG1 not only protected SH-SY5Y cells against cell apoptosis, oxidative stress and neuroinflammation in vitro, pathological damage and neuroinflammation in vivo, but also suppressed the expressions of PTEN and cleaved caspase-3, increased the expressions of TH and Bcl-2 in MPP+-treated SH-SY5Y cells. However, the protective role of siTUG1 in SH- SY5Y cells was significantly inhibited by miR-152-3p inhibitor. Thus, knocking down TUG1
might have a protective effect on PD through miR-152-3p/PTEN pathway.
Keywords: taurineupregulated gene 1; Parkinson’s disease; SH-SY5Y; miR-152-3p; phosphatase and tensin homolog
Introduction
Parkinson’s disease (PD) is a multisystem neurodegenerative disease, with progressive loss of dopaminergic neurons (an important neurotransmitter) as its key pathological changes 1. Its clinical manifestations are classified as motor symptoms and non-motor symptoms 2. Though genetic predisposition and other environmental changes are considered as crucial factors contributing to the disease progression, the pathogenesis of PD is not completely clear. Multiple studies showed that dysfunctions of dopaminergic neurons, neuroinflammation, oxidative stress, mitochondrial dysfunction, and alterations of the human microbiome are all involved in the pathogenesis of PD 3, 4. In recent years, transcriptome studies found the deregulations of genes, signal pathways and biological processes play critical roles in Fungus bioimaging PD 5. Long non-coding RNAs (lncRNAs), which are widely expressed in animals, plants and even in virus [6], are involved in the occurrence and development of a variety of diseases, especially in neurodegenerative diseases 6. Aberrant expressions of lncRNAs in substantia nigra of Parkinson’s patient have been previously detected 6. LncRNA NaPINK1 transcribed from PINK1 (PTEN-induced kinase 1) locus enhances the stability of PINK1 mRNA, and NaPINK1 silencing decreases the expression of PINK1, impairing motor function and abnormal dopamine release 7. LncRNA Uchl1-AS1 is mainly expressed in the nuclei, but under stress stimulation it and will translocate into the cytoplasm tobind Uchl1 mRNA and promote translation of UCHL1, thereby participating in the ubiquitin-proteasome system (UPS) to degrade proteins 8. Dysregulated metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is involved in PD development through regulating α-synuclein expression9.
Leucine-rich repeat kinase 2 region (LRRK2) is involved in the initiation and development of PD. In PD model, overexpression of HOTAIR (Hox transcript antisense intergenic RNA) specifically enhances the stability of LRRK2 mRNA, and subsequently induces apoptosis of dopaminergic neurons 10. LncRNA TUG1 (taurine upregulated gene 1) sponging miR-145a-5p affects the microglial polarization and promotes the release of inflammatory cytokines after nutrition deprivation 11, 12. Currently, the function of TUG1 in PD still remained unclear. A recent research has demonstrated that overexpression of TUG1 leads to neuronal death and thereby promotes the progression of acute cerebral infarction 13. In this study we were interested in investigating the role of TUG1 in dopaminergic neuron death and PD. We aimed to explore the function of TUG1 in PD. The expressions of TUG1 and its potential target gene were detected in the SH-SY5Y cells stimulated by 1-methyl-4- phenylpyridinium (MPP+) and in the mice treated by 1-Methyl-4-phenyl-1,2,3,6- tetrahydropyridine (MPTP). Further experiments were conducted to confirm the function and underlying mechanism of TUG1 in PD.Human SH-SY5Y neuroblastoma cell line (cat: CRL-2266) was purchased from the ATCC (Manassas, VA, USA), and cultured in DMEM medium (Gibco, Carlsbad, CA, USA) containing 10% FBS (Invitrogen, Carlsbad, CA, USA) with 5% CO2 at 37°C. MPP+ (D048, Sigma-Aldrich, St. Louis, MO, USA) were added into the cell medium at final concentrations of 0, 0.5, 1, 2 and 4 mmol/L. To determine the optimal concentration, the cells were respectively incubated with 0, 0.5, 1, 2 and 4 mmol/L of MPP+ for 48 hat 37°C. The optimal incubation time was decided by incubating the cells with MPP+ at 2 mmol/L at 37°C for 0 h, 12 h, genetic carrier screening 24 h, 48 hand 72 h. The RNAs were isolated on ice from the cells using Trizol method at 4°C and reverse-transcribed into cDNAs using acDNA synthesis kit (cat: K1621, Thermo Scientific, Waltham, MA, USA). The CFX96 Touch Real-Time PCR Detection System (cat: 1855195, Bio-Rad, China) and a Universal SYBR® Green Supermix (cat: 1725270, Bio-Rad, China) were applied in qRT-PCR. The reaction conditions were as follows: at 95°C for 5 min, 40 cycles at 95°C for 15 s, at 60°C for 30 s, and then at 70°C for 10 s. β-actin served as a reference control and the relative mRNA content was determined using the 2-ΔΔCt method14. The primers designed for PCR were listed in Table 1.
The absorbance at 570 nm was detected by a microplate reader (cat: N02691, Thermo Fisher Scientific, Waltham, MA, USA). Briefly, 10 µL 5mg/ml MTT solution was added into the 96-well plate to allow cell growth for 48 h. After incubation at 37°C for 4 h, 100 µL formazan was added into each to dissolve the purple crystals. Finally, the absorbance of each well was recorded using a microplate reader. Six parallel experiments of each group were setup. PcDNA 3.1 plasmid containing overexpressed TUG1 with 3’UTR was purchased from Tsingke (China). SiTUG1 and miR-152-3p inhibitor were synthesized by Tsingke (China). The sequences of siTUG1 were as follows: sense oligo: 5’ – UACUGUUUCUUUAAAUGGCGG -3’; anti-sense oligo: 5’- GCCAUUUAAAGAAACAGUACC -3’. miR-152-3pinhibitor main sequence: 5’-CCAAGUUCUGUCAUGCACUGA-3’. Lipofectamine 2000 (Sigma-Aldrich, St. Louis, MO, USA) was used for cell transfection following the specification. After incubation for 48 h, the cells were collected detecting the transfection efficiency and other assays. The SH-SY5Y cells or tissues were lysedin RIPA buffer (cat: P0013C, Beyotime, Jiangsu, China) containing PMSF protease inhibitor (cat: ST506, Beyotime, Jiangsu, China). The protein samples (25 μg in each lane) were separated by 10% sodium dodecyl sulphate- polyacrylamide gel electrophoresis15, and then transferred to polyvinylidene difluoride membranes (Invitrogen, Carlsbad, CA, USA). Next, the membrane was blocked by 5% of skimmed milk (P0216, Beyotime, China) for 10 min at room temperature. After that, the primary antibodies were first incubated with the membranes at 4°C overnight and then with the secondary antibody at room temperature. Finally, the protein signals were detected by BeyoECL Plus chemiluminescence kit (cat: P0018S, Beyotime, Jiangsu, China)and analyzed by ImageJv. 1.48 (National Institutes of Health, USA). The primary antibodies were anti-PTEN (cat: 9559, Cell Signaling Technology, USA); anti-TH (cat: 58844, Cell Signaling Technology, USA); anti-Bcl-2 (cat: 3498, Cell Signaling Technology, USA); anti- cleaved caspase-3 (cat: 9661, CST, Danvers, MA, USA); anti- β-actin (cat: 4970, Cell Signaling Technology, USA).
The secondary antibody was anti-rabbit IgG antibody (HRP, 1: 5000, 7074, Cell Signaling Technology, USA). β -actin served as an internal control. Annexin V-FITC apoptosis detection kit (cat: C1062M) was purchased from Beyotime (China). Theresuspended cells (about 50,000) were centrifuged at 1000 xg for 5 minto remove the supernatant. The cells were incubated with 200 μL Annexin V-FITC binding buffer containing 5 μL Annexin V-FITC and then with 10 μL PI solution at room temperature for 20 min. After that, the cells were placed in anice bath. Finally, cell apoptosis was analyzed by FACSCanto™ system software (v2.4, 646602, BD Biosciences, San Jose, CA, USA). Caspase-3 assay kit (cat: C1168S) was purchased from Beyotime (Jiangsu, China). The cells from different groups were grown in a 96-well plate to reach confluence of 50-70%.Next, 5 μM caspase-3 substrate was added into each well for a 30-min incubation at room temperature in the dark. Then, fluorescence intensity was detected by a microplate reader (PLUS 384, Molecular Devices, USA).The cells were lysedin RIPA reagent (cat: P0013C Beyotime, Jiangsu, China) and centrifuged at 4 °C. The ROS activity of the supernatant was measured by reactive oxygen species assay kit (MAK142, Sigma-Aldrich, St. Louis, MO, USA). For the detection of fluorescence activity, the cell concentration was adjusted to 5 × 105 cells/mL, then according to the instructions, ROS Detection Reagent was diluted into 500× ROS Detection by 40 mL of DMSO, and 1 mL of ROS Detection was added to 1 mL of cells. After incubating for 1 (at 37 °C, with 5% CO2), FACSCanto™ system software (v2.4, 646602, BD Biosciences, San Jose, CA, USA) with λex = 640 and λem = 675 nm was used to detect ROS content of the cells. The samples in the medium during cell culture or substantia nigra homogenate were collected at 4°C and then added into a 96-well ELISA plate. To measure releases of inflammation-related cytokines from the cells or tissues, ELISA kits (Beyotime, China) for determining TNF-α (PT518 for human/ PT512 for mouse) and IL-1β (PI305 for human/ PI301 for mouse) were performed according to the instructions. The absorption value at450 nm was read by a microplate reader (cat: N02691, Thermo Fisher Scientific, Waltham, MA, USA).
Each sample was tested for 6 parallel repeats. The starBase online database (http://starbase.sysu.edu.cn/) was used for the prediction of the binding site between TUG1 and miR-152-3p. The TUG1-wild type cDNA and mutant cDNA containing miR-152-3p target site were inserted into the luciferase reporter plasmid (pmirGLO, cat: E1330, Promega, Madison, WI, USA) as TUG1-WT reporter plasmid and TUG1-MUT luciferase reporter plasmid, respectively. The recombinant reporter plasmids were separately transfected into SH-SY5Y cells. MiR-152-3p mimic or mimic control was also transfected into SH-SY5Y cells containing the luciferase reporter plasmid. After incubation for 48 h, the dual-luciferase assay system (cat: E1910, Promega, Madison, WI, USA) was performed to determining the luciferase activity using a luminometer (11300010, Berthold, Germany). The firefly luciferase activity was normalized against renilla luciferase activity.In brief, a total of 40 normal C57BL/6J mice (male, 8 weeks old, weighting 25 g-27 g, Charles River, China) were randomly divided into the following four groups, with 10 mice in each group: control group (injection of isopyknic nxiaoshuormalsaline), MPTP group (intraperitoneal injection of MPTP (Sigma-Aldrich, 20 mg/kg, 4 times a day), MPTP+siNC (injection of 20 nM lentivirus-siNC for 2 days before the MPTP injection), MPTP+siTUG1 group (injection of 20 nM lentivirus-siTUG1 for 2 days before the MPTP injection). All the mice were sacrificed after the last injection for removing the ventral midbrain, which was maintained at 80 ° C for further study. The lentivirus-siNC andlentivirus-siTUG1 were purchased from Genepharma (China). The tissues were fixed by 4% formaldehyde, paraffin-embedded, and sectioned into 5- μm thick slices.
The slices were stained by hematoxylin for 10 min, then by eosin (C0105, Beyotime, China) for 30 s at room temperature, and washed by 70% ethyl alcohol twice. The slices of a thickness of 5-7 μm were prepared as previously described 16, deparaffinized by a series of xylene (1330-20-7, Aladdin, China) and graded alcohols. For immunohistochemistry assay, antigen retrieval was performed by processing the slices with 3% hydrogen peroxide for 5 min and then by 10 mM citrate at 100 °C for 5 min. After that, the slices were immersed in 3% hydrogen peroxide solution for 5 min for blocking endogenous peroxidase, and then incubate with anti-TH (1:400, cat: ab75875, Abcam, Cambridge, MA, USA) for 80 min at room temperature.Then, the slices were further incubated with 30 µLof DAB (cat: 8059, Cell Signaling Technology, Danvers, MA, USA) at room temperature for 5 min and washed by H2O for 5 min. Anti-rabbit IgG antibody (cat: 7074, Cell Signaling Technology, Danvers, MA, USA) was further incubated with the slices for 2 hat room temperature. The images were captured under an inverted fluorescence microcope (DM2500, Leica, Wetzlar, Germany) and then analyzed by ImageJv. 1.48 (National Institutes of Health, USA). The data were shown as mean ±standard error (SD) and analyzed using Student’s t test or one-way analysis of variance (ANOVA), followed by Bonferroni post hoc test (GraphPad v.6, La Jolla, CA, USA). P <0.05 were considered as statistically significant.
Result
Detection of the expressions of lncRNA TUG1 and miR-152-3p in MPP+ treated SH-SY5Y cells. To identify the relationship between TUG1, miR-152-3p and PD, we detected the expressions of TUG1 and miR-152-3pin SH-SY5Y cells treated with MPP+. The results showed that TUG1 expression was positively regulated by MPP+ treatment in SH-5Y5Y cells in dose- and time-dependent manners (Fig. 1A and C), while miR-152-3pexpression was negatively regulated by MPP+ treatment ( Fig. 1B and D). TUG1 regulated the apoptosis, oxidative stress and neuroinflammation of the SH-5Y5Y cells induced with MPP+. The relation between TUG1 and PD was further explored. TUG1 was overexpressed and knocked down in the SH-5Y5Y cells with MPP+ induction, and its expression was detected by qRT-PCR 48 h after the transfection. The result showed that TUG1 expression was significantly down-regulated in the group of si-TUG1 but up-regulated in the pcDNA- TUG1 group (Fig 2A). MPP+ treatment obviously reduced cell viability of SH-SY5Y, which was attenuated by the down-regulation of TUG1, and overexpressed TUG1 further reduced the cell viability (Fig 2B). The effect of TUG1 on cell apoptosis was also detect by flow cytometry, and we observed that MPP+ incubation obviously increased the apoptosis of SH-SY5Y cells, si-TUG1 significantly reduced the apoptotic cells, but pcDNA-TUG1 plasmid promoted the apoptosis of the cells with MPP+ treatment (Fig 2 C and D). The activity of cleaved caspase 3 was detected from the supernatants to examine the role of TUG1 in apoptosis of the cells with MPP+ treatment. The result demonstrated that the activity of cleaved caspase-3 was increased by MPP+, but obviously reduced by silencing TUG1, and overexpression TUG1 further enhanced the activity of cleaved caspase-3 in the cells incubated with MPP+ (Fig 2 E).
Oxidative stress plays an impotent role in MPP+ induced PD model, thus, the content of ROS was examined to explore whether TUG1 regulated MPP+-caused oxidative stress in the cells. We observed that treatment of MPP+ remarkably increased ROS, while silencing TUG1 mitigated oxidative stress induced by MPP+. In the MPP+ treated cells the ROS level 10 was the highest in presence of overexpressed TUG1 (Fig 2 F and G). Furthermore, to identify the effects of TUG1 on neuroinflammation induced by MPP+, the inflammatory factor of TNF-α and IL-1β in the supernatants were detect by ELISA. The data demonstrated that the inhibition of TUG1 significantly reduced the inflammatory factor release in the MPP+ -induced cells, while up-regulation of TUG1 expression promoted the releasesofTNF-α and IL-1β in the cells incubated with MPP+ (Fig 2 H and I). TUG1 promoted apoptosis through regulating downstream genes. To further identify the effects of TUG1 on the apoptosis of the MPP+induced cells, the expressions of PTEN (pro-apoptosis factor), TH and Bcl-2 were determined by qRT-PCR. The data showed that the expression of PTEN was increased (Fig 3 A-C) and TH and Bcl-2 expressions were reduced (Fig 3 A-C). However, siTUG1 reduced the expression of PTEN and increased the expressions of TH and Bcl-2 in MPP+ treated cells (Fig 3 A-C). Moreover, overexpressed TUG1 enhanced the effect of MPP+ on the gene expressions related to cell apoptosis (Fig 3 A-C).In accordance with the relationship between the expressions of TUG1 and miR-152-3p in SH-5Y5Y cells after MPP+ incubation, the binding site between the two was predicted by starBase (Fig 4 A).
To further confirm whether miR-152-3p was a target of TUG1,the SH- SY5Y cells were co-transfected with TUG1-WT, or TUG1-MUT luciferase reporter plasmid with mimic control, or miR-152-3p mimic. The luciferase activity was found significantly decreased when the cells were co-transfected with TUG1-WT and miR-152-3p mimic compared with that of Shikonin clinical trial the cells co-transfected with TUG1-WT and mimic control (Fig 4 B). To confirm that TUG1 regulated miR-152-3p, TUG1 was silenced and overexpressed in MTT+ treated cells. The data revealed that knocking down TUG1 expression up-regulated miR-152-3p expression, while overexpressed TUG1 down-regulated miR-152-3p expression (Fig MiR-152-3p inhibitor promoted apoptosis, oxidative stress and neuroinflammation of the SH-5Y5Y cells. To investigate whether miR-152-3p was involved in apoptosis of the SH-5Y5Y cells induced by MPP+, si-TUG1, inhibitory control with si-TUG1, and miR- 152-3pinhibitor with si-TUG1 were respectively transfected into the SH-5Y5Y cells after the MPP+ induction for 48 h. In the MPP+ treated cells, the expression of miR-152-3p was up-regulated by si-TUG1 but decreased by miR-152-3p inhibitor (Fig 5 A). Down-regulation of TUG1 expression increased SH-5Y5Y cell viability, but miR-152-3p inhibitor weakened the effect of siTUG1 (Fig 5 B). Additionally, knocking down TUG1 expression inhibited the apoptosis of MPP+-induced SH-5Y5Y cells and activity of cleaved caspase 3, which, however, were reversed by miR-152-3p inhibitor (Fig 5 C-E). MPP+ also remarkably increased ROS in the SH-5Y5Y cells (Fig 5 F-G). Moreover, knocking down TUG1 expression reduced oxidative stress caused by MPP+, but miR-152-3p inhibitor resulted in the opposite effect (Fig 5 F and G). In addition, siTUG1 reduced the expressionsof TNF-α and IL-1β in MPP+ induced cells, and the effects were blocked by miR-152-3p inhibitor (Fig 5 H and I). MiR-152-3p inhibited apoptosis through regulating downstream genes. The expressions of PTEN, TH and Bcl-2 were detected to further study the role of miR- 152-3pin the apoptosis of MPP+ induced cells. As expected, reduced expression of PTEN and increased expressions of TH and Bcl-2 were further promoted by the transfection of siTUG1, and were greatly reduced by miR-152-3p inhibitor (Fig 6 A-C).
The activity of cleaved caspase-3 was markedly reduced by siTUG1 and promoted by miR-152-3p inhibitor (Fig 6 B-C). Down-regulation of TUG1 reduced the apoptosis and neuroinflammation of SH-5Y5Y cells. The role and mechanism of TUG1 in PD were further examined in the MPTP-treated PD mice. Compared with the control group, in the midbrains of the mice, the TUG1 expression was significantly promoted by MPTP but reduced by siTUG1 (Fig 7 A). The expression of miR-152-3p was inhibited by MPTP and increased by siTUG1 (Fig 7 B). According to the HE staining, we found that in the group of MPTP and MPTP+ siNC, substantia nigra cells significantly reduced, neuroastrocytes over-proliferated, the cell size 12 of neurons contracted, moreover, edematous vacuoles and stellate bulges were observed around the capillaries (Fig 7C). Noticeably, siTUG1 injection obviously alleviated the pathological damage in midbrain (Fig 7C). The expressionsofTNF-α and IL-1β were detected in the substantia nigra of each group, suggesting that TUG1 increased the expressionsofTNF-α and IL-1β (Fig 7 D and E). The TH-positive cells in the substantia nigra were also detected by IHC, and we found that the TH expression in substantia nigra was obviously reduced by MPTP treatment, but increased by si-TUG1 (Fig 7 F and G). TUG1 promoted apoptosis through regulating downstream genes in the mice model. The expressions of PTEN, Bcl-2 and cleaved caspase 3 in substantia nigra were detected by qRT-PCR and Western blotting. As shown in Fig 8 A-C, compared with control group, the expressions of PTEN and caspase 3 were significantly increased by MPTP treatment and reduced by silencing TUG1 (Fig 8 A-C). Bcl-2 expression was markedly reduced in the group of MPTP and obviously reduced by silencing TUG1 expression (Fig 8 A-C).
Discussion
The main pathological feature of Parkinson’s disease (PD) is the loss of dopaminergic neurons in the midbrain. The recovery of dopaminergic neurons maybe able to reverse the disease progression, but the essential molecular mechanism underlying PD and dopaminergic neuron injury are not completely clear17. It has been shown that in the substantia nigra of PD patients, lncRNA expression profile is different from that in the healthy controls 18. Previous studies observed that the expressions of lncRNA TUG1 (TUG1)_ and nuclear paraspeckle assembly transcript 1 (NEAT1) are significantly up- regulated in the Huntington-diseased brains19. Moreover, NEAT1 expression is also significantly up-regulated in PD patients20. NEAT1 directly binds to PINK1 and maintains the stability of PINK1 mRNA to promote MPTP-induced autophagy 21. Our results revealed that TUG1 expression was elevated in MPTP-induced models in the PD model mice and MPP+ stimulated SH-SY5Y cells, but knocking down TUG1 expression reduced the apoptosis of MPP+-induced cells and cytotoxicity, evidenced by increased cell viability and reduced ROS. Furthermore, TUG1 knockdown relieved neuroinflammation of the MPP+- induced cells, evidenced by reduced expressionsof TNF-α and IL-1β. Conversely, 13 overexpression of TUG1 promoted apoptosis, cytotoxicity, ROS and neuroinflammation of the MPP+-induced cells. These results indicated that TUG1 might play an important role in PD progression, which has not been reported yet.
TUG1 sponging microRNAs (miRNAs) regulates life activities 12, 22. TUG1 is involved in cell apoptosis through sponging miRNA-9 toup-regulate Bcl2l11 expression 23. We further investigated the mechanism of TUG1 in with miRNAs, and it was shown that miR-152-3p was a potential downstream target of TUG1. In MPP+- induced SH-5Y5Y cells, miR-152-3p expression was significantly decreased in time- and dose-dependent manners. Inhibition of miR-152-3p aggravated injury of neurons induced by MPP+, because we found decreased number of apoptotic cells after treatment with miR-152-3p inhibitor. MiR-152-3p reduced apoptosis, ROS and neuroinflammation of the MPP+-induced cells, evidenced by increased expressionsofTNF-α and IL-1β. Knocking down TUG1 expression in MPP+-induced neurons was reversed by inhibitor of miR-152-3p, suggesting that TUG1/ miR-152-3paxis plays an important role in the biological processes of PD.MiR-152 belongs to the family of miR-148/miR-15224, which consists of miR-148a, miR-148band miR-152-3p and miR-152-5p. It has been reported that miR-152-3pisa regulator of PTEN through directly binding with 3’-UTR of PTEN mRNA. Down-regulation of PTEN expression can inhibit cell apoptosis 25, 26. Our result confirmed that the inhibitor of miR-152-3p significantly increased the expression of PTEN.In this research, we found that PTEN was a downstream gene of the TUG1/ miR-152-3paxis and participated in the regulation of MPP+-induced SH-5Y5Y cell apoptosis. However, whether PTEN was directly targeted by miR-152-3pin MPP+ induced SH-5Y5Y cells still remains to be further confirmed.Severe oxidative stress and increased inflammatory responses are developed in MPP+- induced models 27.
In our experiment, TNF-α and IL-1β expressions were significantly up-regulated in the PD cells and mouse models.TNF-α promotes the expression of PTEN through the activation of NF- κB, and both TNF-α and PTEN can promote cell apoptosis 28-30. We found that overexpressed TUG1 increased the expression of TNF-α, which was then blocked by siRNA of TUG1, suggesting that TUG1 could also elevate the expression of PTEN through regulating TNF-α.The mechanism of the role of TUG1 in cell apoptosis is more complex than expected. Our current results partially explained the mechanism underlying the apoptosis of the MPP+-induced dopamine neuron cells. Our findings provide a better understanding of the functions of TUG1 in regulating apoptosis of PD. MPP+ induced apoptosis of dopaminergic neurons via the aixs of TUG1/ miR-152-3p/PTEN. TUG1 can regulate the expression of TNF- α, showing its role in the apoptosis of PD. However, the effects of overexpressed TUG1 and up-regulated PTEN on the MPTP-induced mice should be further explored, and the exact mechanisms through which TUG1 induced PTEN expression in PD also requires in- depth investigation.
In conclusion, TUG1 expression was increased in MPP+ induced SH-SY5Y cells and MPTP-treated PD mice. TUG1 reduced the expression of miR-152-3p in SH-SY5Y cells induced by MPP+ and in the mice treated by MPTP. Overexpressed TUG1 or silencing TUG1 expression regulated cell viability and apoptosis through miR-152-3pin vitro and modulated the pathological damage in substantia nigra of PD mice in vivo. Additionally, the expression of miR-152-3p, which acted as a TUG1 sponge, was inhibited in MPP+- induced SH-SY5Y cells and MPTP-induced mice. Our research provides a new understanding of TUG1 on PD progression.